Molecular Basis of Inheritance

Which of the following enzymes synthesizes precursor mRNA?

Which of the following statements about lac-operon is correct?

The sixth mutant codon of beta globin gene causing polymerization of Haemoglobin and change in RBC shape is $\_\_\_\_$

Which of the following statements are correct with reference to packaging of DNA helix ?
A. Histones are organized to form a unit of eight molecules called histone octamer.
B. Histones are negatively charged basic proteins.
C. Histones are ...

Arrange the following steps of DNA fingerprinting in a correct sequence.
A. Isolation of DNA and its digestion by restriction endonucleases.
B. Hybridisation using a labelled VNTR probe.
C. Transferring of separated DNA fragments to synthet...

Which of the following statements are correct with reference to a transcription unit?
A. A transcription unit in DNA is defined primarily by three regions : promoter, structural gene and terminator.
B. The promoter is said to be located tow...

In the lac operon, the $\boldsymbol{z}$ gene codes for

Which factor is important for termination of transcription?

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

Given below are two statements:
Statement I: In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical ...

Which of the following are the post-transcriptional events in an eukaryotic cell?
A. Transport of pre-mRNA to cytoplasm prior to splicing.
B. Removal of introns and joining of exons.
C. Addition of methyl group at 5' end of hnRNA.
D. Additi...

Given below are two statements :
Statement 1 : Transfer RNAs and ribosomal RNA do not interact with mRNA.
Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence.
In the light of the ab...

Which chromosome in the human genome has the highest number of genes?

Match List-I with List-II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...

Given below are two statements :
Statement I : RNA interference takes place in all Eukaryotic organisms as method of cellular defense.
Statement II : RNAi involves the silencing of a specific mRNA due to a complementary single-stranded RNA ...

Given below are two statements:
Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA
polymerase found in the organelles.
Statement II: All the three RNA polymerases in eukaryotic nucleus have diff...

Given below are two statements :
Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for
the hydrolysis of lactose into galactose and glucose.
Statement II: In addition to lactose, glucose...

Given below are two statements regarding RNA polymerase in prokaryotes.
Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during
transcription.
Statement II : RNA polymerase associate transient...

In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:

Match List I with List II :

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;...

Which of the following statement is correct regarding the process of replication in E.coli?

Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...

Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'

Match List I with List II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

The lactose present in the growth medium of bacteria is transported to the cell by the action of

The salient features of genetic code are :
(A) The code is palindromic
(B) UGA act as initiator codon
(C) The code is unambiguous and specific
(D) The code is nearly universal
Choose the most appropriate answer from the
options g...

With reference to Hershey and Chase experiments.
Select the correct statements.
(A) Viruses grown in the presence of radioactive
phosphorus contained radioactive DNA.
(B) Viruses grown on radioactive sulphur contained
radioactive prot...

Which one of the following acts as an inducer for
lac operon ?

Select the correct statements about sickle cell
anaemia.
(A) There is a change in gene for beta globin.
(B) In the beta globin, there is valine in the place of
Lysine.
(C) It is an example of point mutation.
(D) In the normal gene...

Given below are two statements :
Statement I : RNA being unstable, mutate at a faster rate.
Statement II : RNA can directly code for synthesis of proteins hence can easily express the characters.
In the light of the above statements, choo...

Which scientist conducted an experiment with 32P
and 35S labelled phages for demonstrating that DNA is the genetic material?

Given below are two statements :
Statement I : The process of copying genetic information from one strand of the DNA into RNA is termed as transcription.
Statement II : A transcription unit in DNA is defined primarily by the three region...

Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.

The last chromosome sequenced in Human Genome Project was:

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA
formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a
region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around th...

Match List I with List II.

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

Expressed Sequence Tags (ESTs) refers to

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Unequivocal proof that DNA is the genetic material was first proposed by

If A and C make 30% and 20% of DNA, respectively, what will be the percentage composition of T and G?

Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?

Match List-I with List-II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

Match List - I with List - II.

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:norm...

Given below are two statements
Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'.

Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is
...

In lac operon, z gene codes for

Ten E.coli cells with 15N - dsDNA are incubated in medium containing 14N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from 15N?

In an E. Coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?