Neet

Molecular Basis Of Inheritance

NEET 2024

MCQ+4 / -12024

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3'TACATGGCAAATATCCATTCA5'

Continue this paper

Previous questionMolecular Basis Of Inheritance2024MCQ Next questionMolecular Basis Of Inheritance2024MCQ

Similar Molecular Basis Of Inheritance PYQs

Neet questionMolecular Basis Of Inheritance2026MCQ Neet questionMolecular Basis Of Inheritance2026MCQ Neet questionMolecular Basis Of Inheritance2026MCQ Neet questionMolecular Basis Of Inheritance2026MCQ Neet questionMolecular Basis Of Inheritance2026MCQ Neet questionMolecular Basis Of Inheritance2026MCQ

More practice from this question

All Molecular Basis Of Inheritance PYQsBiology NEET 20242024 Browse Neet chapters