NEET 2024

Match List I with List II :

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;...

Which of the following are Autoimmune disorders?
A. Myasthenia gravis
B. Rheumatoid arthritis
C. Gout
D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:

Match List I with List II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

Given below are two statements :
Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.
Statement II : Both bone marrow and thymus provide micro environments for the development and ma...

Given below are two statements:
Statement I: The presence or absence of hymen is not a reliable indicator of virginity.
Statement II: The hymen is torn during the first coitus only.
In the light of the above above statements, choose the cor...

Which of the following is not a component of Fallopian tube?

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

Match List I with List II :

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;...

Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body:

Name of muscle/location

Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...

The lactose present in the growth medium of bacteria is transported to the cell by the action of

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

Match List I with List II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'

Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...

Which of the following statement is correct regarding the process of replication in E.coli?

Match List I with List II :

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;...

Which of the following is an example of actinomorphic flower?

Bulliform cells are responsible for

Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...

Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b)

Given below are two statements:
Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.
In the light of the above statem...

Match List I with List II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

The equation of Verhulst-Pearl logistic growth is \(\frac{\mathrm{dN}}{\mathrm{dt}}=\mathrm{rN}\left[\frac{\mathrm{K}-\mathrm{N}}{\mathrm{K}}\right]\).
From this equation, \(\mathrm{K}\) indicates:

Given below are two statements:
Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.
Statement II: According to Gause's principle, during c...

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

Which of the following are required for the dark reaction of photosynthesis?
A. Light
B. Chlorophyll
C. \(\mathrm{CO}_2\)
D. ATP
E. NADPH
Choose the correct answer from the options given below:

Given below are two statements:
Statement I: In \(\mathrm{C}_3\) plants, some \(\mathrm{O}_2\) binds to \(\mathrm{RuBisCO}\), hence \(\mathrm{CO}_2\) fixation is decreased.
Statement II: In \(\mathrm{C}_4\) plants, mesophyll cells show very...

How many molecules of ATP and NADPH are required for every molecule of \(\mathrm{CO}_2\) fixed in the Calvin cycle?

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

Formation of interfascicular cambium from fully developed parenchyma cells is an example for

Read the following statements and choose the set of correct statements:
In the members of Phaeophyceae,
A. Asexual reproduction occurs usually by biflagellate zoospores.
B. Sexual reproduction is by oogamous method only.
C. Stored food is i...

Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors one is dominant and the other is recessive.
B. Alleles do not show any expression and both the characters appear as such in...

Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...

In a plant, black seed color \((\mathrm{BB} / \mathrm{Bb})\) is dominant over white seed color \((\mathrm{bb})\). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

As per ABO blood grouping system, the blood group of father is \(\mathrm{B}^{+}\), mother is \(\mathrm{A}^{+}\) and child is \(\mathrm{O}^{+}\). Their respective genotype can be
A. IBi/IAi/ii
B. IBIB/IAIA/ii
C. iIB/iIA/IAIB
D. IAi/IBi/IAi
E...

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...

Which of the following is not a natural/traditional contraceptive method?

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.
Reason R : Colo...

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...

Identify the set of correct statements:
A. The flowers of Vallisneria are colourful and produce nectar.
B. The flowers of water lily are not pollinated by water.
C. In most of water-pollinated species, the pollen grains are protected from w...

Identify the correct description about the given figure :

Match List I with List II related to digestive system of cockroach.

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hi...

Match List I with List II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on