PracBeeLogin

NEET 2024

NEET / 100 questions

2026Sun, May 5, 2024 8:30 AM100 PYQs
1Human Health And Diseases
Match List I with List II :

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;...
MCQ+4 / -12024
2Human Health And Diseases
Which of the following are Autoimmune disorders?
A. Myasthenia gravis
B. Rheumatoid arthritis
C. Gout
D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:
MCQ+4 / -12024
3Human Health And Diseases
Match List I with List II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...
MCQ+4 / -12024
4Human Health And Diseases
Given below are two statements :
Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.
Statement II : Both bone marrow and thymus provide micro environments for the development and ma...
MCQ+4 / -12024
5Human Reproduction
Given below are two statements:
Statement I: The presence or absence of hymen is not a reliable indicator of virginity.
Statement II: The hymen is torn during the first coitus only.
In the light of the above above statements, choose the cor...
MCQ+4 / -12024
6Human Reproduction
Which of the following is not a component of Fallopian tube?
MCQ+4 / -12024
7Human Reproduction
Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.
MCQ+4 / -12024
8Locomotion And Movement
Match List I with List II :

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;...
MCQ+4 / -12024
9Locomotion And Movement
Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body:

Name of muscle/location
MCQ+4 / -12024
10Microbes In Human Welfare
Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...
MCQ+4 / -12024
11Molecular Basis Of Inheritance
The lactose present in the growth medium of bacteria is transported to the cell by the action of
MCQ+4 / -12024
12Molecular Basis Of Inheritance
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
MCQ+4 / -12024
13Molecular Basis Of Inheritance
Match List I with List II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...
MCQ+4 / -12024
14Molecular Basis Of Inheritance
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
MCQ+4 / -12024
15Molecular Basis Of Inheritance
Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...
MCQ+4 / -12024
16Molecular Basis Of Inheritance
Which of the following statement is correct regarding the process of replication in E.coli?
MCQ+4 / -12024
17Molecular Basis Of Inheritance
Match List I with List II :

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;...
MCQ+4 / -12024
18Morphology Of Flowering Plants
Which of the following is an example of actinomorphic flower?
MCQ+4 / -12024
19Morphology Of Flowering Plants
Bulliform cells are responsible for
MCQ+4 / -12024
20Morphology Of Flowering Plants
Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...
MCQ+4 / -12024
21Morphology Of Flowering Plants
Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...
MCQ+4 / -12024
22Morphology Of Flowering Plants
Identify the part of the seed from the given figure which is destined to form root when the seed germinates.
MCQ+4 / -12024
23Morphology Of Flowering Plants
Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b)
MCQ+4 / -12024
24Neural Control And Coordination
Given below are two statements:
Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.
In the light of the above statem...
MCQ+4 / -12024
25Neural Control And Coordination
Match List I with List II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...
MCQ+4 / -12024
26Organisms And Populations
The equation of Verhulst-Pearl logistic growth is \(\frac{\mathrm{dN}}{\mathrm{dt}}=\mathrm{rN}\left[\frac{\mathrm{K}-\mathrm{N}}{\mathrm{K}}\right]\).
From this equation, \(\mathrm{K}\) indicates:
MCQ+4 / -12024
27Organisms And Populations
Given below are two statements:
Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.
Statement II: According to Gause's principle, during c...
MCQ+4 / -12024
28Organisms And Populations
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
MCQ+4 / -12024
29Photosynthesis In Higher Plants
Which of the following are required for the dark reaction of photosynthesis?
A. Light
B. Chlorophyll
C. \(\mathrm{CO}_2\)
D. ATP
E. NADPH
Choose the correct answer from the options given below:
MCQ+4 / -12024
30Photosynthesis In Higher Plants
Given below are two statements:
Statement I: In \(\mathrm{C}_3\) plants, some \(\mathrm{O}_2\) binds to \(\mathrm{RuBisCO}\), hence \(\mathrm{CO}_2\) fixation is decreased.
Statement II: In \(\mathrm{C}_4\) plants, mesophyll cells show very...
MCQ+4 / -12024
31Photosynthesis In Higher Plants
How many molecules of ATP and NADPH are required for every molecule of \(\mathrm{CO}_2\) fixed in the Calvin cycle?
MCQ+4 / -12024
32Plant Growth And Development
Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?
MCQ+4 / -12024
33Plant Growth And Development
Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
MCQ+4 / -12024
34Plant Growth And Development
Formation of interfascicular cambium from fully developed parenchyma cells is an example for
MCQ+4 / -12024
35Plant Kingdom
Read the following statements and choose the set of correct statements:
In the members of Phaeophyceae,
A. Asexual reproduction occurs usually by biflagellate zoospores.
B. Sexual reproduction is by oogamous method only.
C. Stored food is i...
MCQ+4 / -12024
36Principles Of Inheritance And Variation
Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors one is dominant and the other is recessive.
B. Alleles do not show any expression and both the characters appear as such in...
MCQ+4 / -12024
37Principles Of Inheritance And Variation
Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...
MCQ+4 / -12024
38Principles Of Inheritance And Variation
In a plant, black seed color \((\mathrm{BB} / \mathrm{Bb})\) is dominant over white seed color \((\mathrm{bb})\). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?
MCQ+4 / -12024
39Principles Of Inheritance And Variation
As per ABO blood grouping system, the blood group of father is \(\mathrm{B}^{+}\), mother is \(\mathrm{A}^{+}\) and child is \(\mathrm{O}^{+}\). Their respective genotype can be
A. IBi/IAi/ii
B. IBIB/IAIA/ii
C. iIB/iIA/IAIB
D. IAi/IBi/IAi
E...
MCQ+4 / -12024
40Principles Of Inheritance And Variation
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
MCQ+4 / -12024
41Reproductive Health
Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...
MCQ+4 / -12024
42Reproductive Health
Which of the following is not a natural/traditional contraceptive method?
MCQ+4 / -12024
43Reproductive Health
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.
Reason R : Colo...
MCQ+4 / -12024
44Respiration In Plants
Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
MCQ+4 / -12024
45Respiration In Plants
Match List I with List II

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}
...
MCQ+4 / -12024
46Sexual Reproduction In Flowering Plants
Identify the set of correct statements:
A. The flowers of Vallisneria are colourful and produce nectar.
B. The flowers of water lily are not pollinated by water.
C. In most of water-pollinated species, the pollen grains are protected from w...
MCQ+4 / -12024
47Sexual Reproduction In Flowering Plants
Identify the correct description about the given figure :
MCQ+4 / -12024
48Structural Organisation In Animals
Match List I with List II related to digestive system of cockroach.

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hi...
MCQ+4 / -12024
49Structural Organisation In Animals
Match List I with List II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...
MCQ+4 / -12024
50Structural Organisation In Animals
In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on
MCQ+4 / -12024

More 2026 NEET papers