NEET 2023

Given below are two statements:
Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory
duct.
Statement Il: The cavity of the cervix is called cervical canal which along with vagina forms bi...

Match List I with List II.

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

Which of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions....

Which micronutrient is required for splitting of water molecule during photosynthesis?

Match List I with List II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

Unequivocal proof that DNA is the genetic material was first proposed by

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Expressed Sequence Tags (ESTs) refers to

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

Match List I with List II.

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a
region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around th...

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA
formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the
characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral
meristem.
Reason R : Internode ...

Match List I with List II with respect to human eye.

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10...

The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure,
rage, fear etc. are:

Given below are two statements:
Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated ...

Match List I with List II.

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

Match List I with List II.

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle?

The reaction centre in PS II has an absorption maxima at

Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period,
that leads early seed production?

Which hormone promotes internode/petiole elongation in deep water rice?

Identify the pair of heterosporous pteridophytes among the following :

Given below are two statements : One labelled as Assertion A and the other labelled as Reason R:
Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores p...

Frequency of recombination between gene pairs on same chromosome as a measure of the distance
between genes to map their position on chromosome, was used for the first time by

The phenomenon of pleiotropism refers to

Which of the following statements are correct about Klinefelter’s Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expr...

Broad palm with single palm crease is visible in a person suffering from-

Which one of the following symbols represents mating between relatives in human pedigree analysis?

Axile placentation is observed in

Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R.
Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health
Care Programme.
Reason R : Ban on...

Match List I with List II.

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and se...

Which of the following combinations is required for chemiosmosis?

Match List I with List II:

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of

What is the function of tassels in the corn cob?

Large, colourful, fragrant flowers with nectar are seen in

In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :

Given below are two statements : One labelled as Assertion A and the other labelled as Reason R :
Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air
currents.
Reason R : Air currents car...

Which one of the following is NOT an advantage of inbreeding?

Given below are two statements:
Statement I : Ligaments are dense irregular tissue.
Statement II : Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below:

Match List I with List II.

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;}...

In cockroach, excretion is brought about by -
A. Phallic gland
B. Urecose gland
C. Nephrocytes
D. Fat body
E. Collaterial glands
Choose the correct answer from the options given below :

Which of the following is characteristic feature of cockroach regarding sexual dimorphism?

Movement and accumulation of ions across a membrane against their concentration gradient can be
explained by

Given below are two statements :
Statement I : The forces generated transpiration can lift a xylem-sized column of water over 130 meters
height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees evaporative coolin...

Identify the correct statements:
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark formed early in the season is called hard bark.
C. Bark is a technical term that refers to all tissues exterior to vascular...

Match List I with List II :

.tg {border-collapse:collapse;border-spacing:0;}
.tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size:14px;
overflow:hidden;padding:10px 5px;word-break:normal;...